taxonID	type	description	language	source
706976143815FFF7FF7A351CFBC6FEAD.taxon	type_taxon	Type species: Chrysopa umbrosa Navás, 1914 b, by original designation.	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143815FFF7FF7A351CFBC6FEAD.taxon	diagnosis	Diagnosis. See Breitkreuz et al. (2021).	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143815FFF7FF7A351CFBC6FEAD.taxon	distribution	Distribution. Afrotropical, Australian, Nearctic, Oriental, and Palaearctic regions.	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143816FFF2FF7A33C0FE01FBAC.taxon	description	(Figs 2 – 4)	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143816FFF2FF7A33C0FE01FBAC.taxon	diagnosis	Diagnosis. Body small-sized, greenish. Head with reddish markings on frons and scape, without dark spots on gena. Thorax with reddish markings. Abdomen reddish ventrally. Wing veins mostly pale, with gradates brown. Male genitalia without tignum.	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143816FFF2FF7A33C0FE01FBAC.taxon	description	Description. Adult. Body mostly pale green, 8.1 – 9.5 mm long (Fig. 2 A). Head. 1.1 – 1.7 mm wide (including compound eyes). Yellowish, with genal marking absent; frons reddish entirely, reddish spots present on intra-antennal frons. Mandibles asymmetrical, broad; labial and maxillary palpi yellowish, brownish on base of palpomeres 2 – 3, brownish and slightly tapered apically. Antenna longer than forewing, brownish, but pale at base; scape with reddish stripes laterally, pedicel unmarked, flagellar setael arranged as four rings, flagellum yellowish, setae brownish (Fig. 2 B, C, D, E). Thorax. Greenish, pronotum about 1.2 times as longer as wide; setae pale, with three pairs of brownish markings respectively near anterior angels, middle and posterior margin; a yellowish longitudinal median stripe with reddish line, present on pro-, meso- and metanotum (Fig. 2 B, C, D). Legs. Greenish yellow, unmarked, covered with brown setae; claws curved, brown. Forewing. 10.0 – 13.3 mm long. Rounded apically; tegula unmarked; veins mostly greenish, but gradate crossveins, last crossvein between PsM and PsC, and 1 st crossvein between PsC and CuP marked brown; setae long, dark, relatively short basally; costal area narrowly at base, costal crossveins simple, 16 costal crossveins present, slightly sinuous on fourth and fifth crossveins; pterostigma greenish; Sc and RA not fused, basal subcostal crossvein present, three distal sc-r crossveins posterior pterostigma; 11 radial crossveins present, intramedian cell triangular, subdistally connected by a rp-m crossvein to R; two gradate series of crossveins present, number of gradates (inner / outer): 5 / 5; gradate series not absolutely parallel, basal crossveins of first gradate series not meeting PsM; dcc open, CuP not forked (Fig. 2 A, F). Hind wing. 9.2 – 11.2 mm long. Pterostigma greenish, veins pale; 16 costal crossveins present; four distal sc-r crossveins posterior pterostigma; six crossveins between PsC and PsM present; two gradate series of crossveins present, number of gradates (inner / outer): 3 / 6 (Fig. 2 A). Abdomen. Greenish; yellowish longitudinal median stripe with reddish margin on tergum; sterna reddish; setae pale (Fig. 2 A). Male genitalia. Tergite 9 and ectoprocts fused, ectoproct rounded; ventral apodeme regular; sternites 8 and 9 fused, regular, without dense setae. Tignum absent; gonarcus medially fused, with long ovate lateral pieces; entoprocessus large, ventrally curved apex, positioned at joint of medial arch and lateral arms; mediuncus closely associated with gonarcus, with membranous connection; gonapsis present, small, with short bilobed apex and narrow side-pieces; hypandrium internum triangular, V-shaped in lateral view, with a thin rod medially; gonosetae sparsely present; microtholi absent (Fig. 3 A, C, D, E, F). Female genitalia. Tergite 9 and ectoprocts fused; sternite 7 simple, apically rounded; praegenitale absent; small sclerotized plate between subgenitale and sternum 7 absent; subgenitale as long as broad; spermatheca surface smooth; vela smaller than spermatheca; spermathecal duct curved (Fig. 3 B, G, H). Semaphorom I (Fig. 4 C, D). Body. Small, compact, dorsal surface not abruptly elevated. Integument smooth, without microtrichia, bearing four types of setae: (i) long to medium length, stout, slightly denticulate, with acute tip (primary cephalic setae); (ii) long, robust, denticulate and straight basally, curved distally, with acute apex (most setae on lateral and laterodorsal tubercles of thorax and abdomen; LS, LDS); (iii) long, slender, smooth, curved setae (SMS), tapered and thin distally on dorsum of mesothorax, metathorax, and first to sixth abdominal segments; (iv) long, curved, smooth, with acute tip (some primary setae on head, pronotum, seventh and eighth abdominal segments). Head. Dorsum smooth, well sclerotized; posterior margin quadrate, partially retracted into cervix; anterior region beneath base of antenna forming pedicellate extension. Six stemmata, all well separated, relatively small. All primary cephalic setae (S 1 – S 12) present, with acute tips. S 1 and S 11 robust, long, directed anteriorly; S 2, S 3, S 5, S 6, S 12 medium length, robust, but slightly slender than S 1 and S 11; anterior region of head with two pairs of small, smooth, acute setae; anterior tip of clypeus with pair of large, slightly denticulate, acute setae projecting anteriorly. Venter with cardo and stipes robust, elongate, and rectangular; primary setae (S 8 – S 10) smooth, short to medium length; S 8 posterior to eye; S 9, S 10 near each other, medial to eye. Ventral midregion with pairs of setae. Head appendages. Clypeus large, extending laterally toward base of mandibles. Mandible long, slender, heavily sclerotized; with sharply acute tip. Maxilla broad basally, with basolateral setae; round distally, heavily sclerotized, with small patch of microsetae. Labial palpus with terminal segment slender, tapering distally, terminus with small, pale, round projection, bearing ventral pore and several microsetae apically. Basal palpus segment with two pairs of long distal setae. Antennal scape set within pedicel elongate, tapering, with irregular annulations. Flagellum round in cross section, narrow, tapering to flagellum; terminus with two elongate, terminal setae curving toward each other, with mesal seta usually longer than lateral one. Cephalic coloration. Anterodorsal surface of head pale, with a pair of brownish bands anteriorly, and two pairs of brownish spots; integument around and between stemmata brownish. Venter margin sclerites brownish; intersegmental membrane pale. Antenna with scape brownish; pedicel pale, with base and annulations brownish; flagellum brownish to amber. Mandible and maxilla brownish basally. Thorax. Each segment with pair of broad, thick, palmate, lateral tubercles (LTs); distal margin of each LT with robust chalazae bearing prominent setae (LS); LS long, robust, with tip brownish, curved. Prothorax pale, with a pair of brownish spots, surface smooth, well sclerotized, with sparse setae, no microsetae; each LT with three or four LS; pronotal setae medium length, straight, with acute tips. Dorsal mesothorax with a pair of brownish spots, meso- and metathorax with dense submedian setae (SMS) dark brown, no microsetae; LTs similar to those on prothorax, each bearing three or four long LS; laterodorsal tubercles (LDTs) absent; SMS arranged in two broad bands across surface of each segment; SMS medium length, slender. Leg. Dark brown distally, pale basally; setae pale, with acute tips. Coxa with few setae; femur and tibia with numerous setae; claws slender, deeply cleft; empodium long. Abdomen. First segment (A 1) short, narrow, without spiracle, LT, or LDT; with transverse band of dense SMS dorsally. Segments A 2 – A 5 longer and broader than A 1, bearing a pair of bulbous LTs, round spiracular opening near dorsomesal margin of LT, without laterodosal tubercles (LDTs). LTs brownish dorsally, with two denticulate LS, no microsetae; segment with dense SMS. Segments A 6 – A 7 each with a pair of laterodorsal tubercles (LDTs). LDTs bearing two robust, long, acute setae (LDS), curved, brownish at tips; segments without microsetae, posterior section without setae. Segment A 8 with short, bulbous LT laterally, with robust, denticulate LS. Anterior section of segments A 9 and A 10 with pair of very small setae dorsally, and midsection with a pair of short, robust setae laterally. Segment A 10 without setae except for single pair of smooth, acute setae near terminus. Semaphorom III (Fig. 4 A, B, E, F, G). Body. Stocky, globose dorsally, flat ventrally; thoracic, abdominal notum wide, extending fully over sides of body. Thorax and abdomen with dark transverse bands, separated by pale bands and intersegmental membrane. Four types of setae: (i) smooth, unhooked; (ii) stout, short, straight, with acute tip; (iii) stout, with blunt to acute tip; (iv) simple, small, straight, with acute tip (Fig. 4 A, B, E, F, G). Head. Subquadrate; anterior margin slightly convex, dorsal setae dark. Head appendages. Mandibles long, slender, with acute tip. Antenna long, slender, tapering; scape with stout setae on distolateral margin; pedicel annulated; flagellum tapered, apparently with elongate terminal setae. Cervix dark, probably well sclerotized (Fig. 4 A, B, E, F). Head coloration. Mandible and maxilla brownish basally. Anterodorsal surface of head brownish, with a pair of pale curved at base of each scape, from posterior and meet each other, nearly Y-shaped, and a pair of slender pale bands near each eye; integument around and between stemmata dark brown. Venter with sclerites margin dark brown; intersegmental membrane pale. Antenna with scape, base of pedicel brownish; pedicel pale, with annulations brownish; flagellum brownish to amber. (Fig. 4 A, B, E, F). Thorax. Broad, dorsoventrally thickened, each with a pair of LTs; LTs robust, rounded distally, bearing robust LS, with sparse acute setae dorsally; prothorax with a pair of dark brown band and a vertical brown band, meso- and metathorax each with a pair of black spots. Legs stocky, pale; claws dark (Fig. 4 E, F, G). Abdomen. Segments A 1 – A 6 broad, thick; together with thorax forming large, densely setose, dorsal arch of body; A 1 with subsegment, without LTs, dorsally about as long and wide as metathoracic posterior subsegment, excluding LTs. Segments A 2 – A 6 each with two subsegments dorsally; LTs round, spherical distally, bearing robust, curved LS brown distally, and smaller, hooked setae dorsally. Segments A 7 – A 10 with each segment narrower than A 6, with sparse, short, acute setae. A 8 with small lateral LTs bearing short, slender, acute setae; spiracles at base of segment. A 9, A 10 without LTs, short, slender, acute setae present (Fig. 4 G).	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143816FFF2FF7A33C0FE01FBAC.taxon	materials_examined	Type material. Holotype ♁, CHINA, Guangdong, Zhanjiang, sisal fields of South Subtropical Crops Research Institute CATAS, 21 ° 17 ′ N, 110 ° 29 ′ E, VI. 2019, Ziyuan Li (CAU); paratypes 5 ♁ 6 ♀, same data as holotype (CAU). Larval specimens examined. First and second instar, 6 individuals; third instar, 4 individuals. All larvae reared from the eggs laid by female adults collected from same locality as holotype (CAU).	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143816FFF2FF7A33C0FE01FBAC.taxon	etymology	Etymology. The specific epithet refers to Latin, roseus and frons, means reddish frons, based on the reddish frons of the new species.	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143816FFF2FF7A33C0FE01FBAC.taxon	distribution	Distribution. China (Guangdong).	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143816FFF2FF7A33C0FE01FBAC.taxon	discussion	Remarks. Beside the new species, there are only six species in Apertochrysa without tignum: A. afghanica Hölzel, 1973, A. eremita Kimmins, 1955, A. eurydera Navás, 1910, A. joannisi Navás, 1910, A. puncticollis Banks, 1940 and A. umbrosa Navás, 1914. The new species can be identified from these species by the reddish frons and gena without dark spots. Concerning the absence of tignum in Apertochrysa, Breitkreuz et al. (2021) mentioned that such absence may be due to some unknown artificial causes, such as incidental loss during dissection. However, we here confirm that the absence of tignum in the new species is of natural condition based on careful examination of multiple males. Thus, for the other Apertochrysa species without tignum, we cannot simply rule out the natural loss of this genital sclerite, and should clarify this problem by reexamination of more specimens. COI barcode sequence. AATAATATAGTAATAGCTCCTGCTAAAACAGGTAATGATAATAAAAGTAATAAAGCTGTAATAACA ACTGACCAAACAAATAAAGGTATTCGATCTAAAGTTATATAACTTAATCGTATATTAATAACTGTGG TAATAAAATTAACAGCTCCTAAAATAGAAGAAATTCCAGCTAAATGTAAACTAAAAATAGCTAAAT CAACAGATGCTCCAGCATGAGCAATTCTTGCAGAAAGAGGGGGGTATACAGTTCATCCTGTTCCAGC TCCTCTTTCTACTATTGAAGATGCTAGGAGTAGAGTTAAAGAAGGAGGTAATATTCAAAAACTTATA TTATTTATACGAGGAAAAGCTATATCAGGAGCTGCTAATATTAAAGGAACTAATCAATTACCAAATC CTCCAATTACAATAGGTATTACTATAAAAAAAATTATAATAAAAGCATGAGCAGTAACAATTACAT TGTAAATTTGATCATCACCAATTAATGATCCTGGTTGACCTAATTCAGCTCGAATTAATAAACTTAA ACTTGTACCTACTAATCCAGATCAAATTCCAAAAATAAAATATAAAGTTCCAATATCCTTATGGTTA GTTGAAAATAATCA	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143813FFF2FF7A36C9FCCCFA2C.taxon	type_taxon	Type species: Chrysopa brasiliensis Schneider, 1851: 83, by original designation.	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143813FFF2FF7A36C9FCCCFA2C.taxon	diagnosis	Diagnosis. Medium to large green lacewings; body color mostly greenish, head marked or not; palpus tapered apically, mandibles broad, asymmetrical. Pronotum sometimes elongate, marked or not; meso- and metanotum marked or not. Male genitalia with asymmetrical pseudopenis, and bending entoprocessus; tignum absent (in the Old World species) or present (in the New World species).	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143813FFF2FF7A36C9FCCCFA2C.taxon	distribution	Distribution. Australian, Neotropical, and Oriental regions.	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143813FFF8FF7A3477FD67FE00.taxon	description	(Figs 5 – 7)	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143813FFF8FF7A3477FD67FE00.taxon	diagnosis	Diagnosis. Body medium-sized. Head with a pair of black stripes on frons, two pairs of black stripes on vertex, and two pairs of black stripes on scape. Thorax with three pairs of black markings. Abdomen with a pair of black spots and a pair of black stripes. Wing veins mostly pale with gradates and some longitudinal veins brown basally.	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143813FFF8FF7A3477FD67FE00.taxon	description	Description. Adult. Body mostly pale green, 9.5 – 10.9 mm long (Fig. 5 A, E). Head. 1.6 – 1.9 mm wide (including compound eyes). Mostly greenish, with a pair of black transverse stripes on frons, a pair of black stripes present around antennal socket, and two long black stripes on occiput. Mandibles asymmetrical, broad. Antenna with scape greenish, marked with black stripes laterally and dorsally, less than 1.5 x wide; pedicel brownish, with a black marking laterally; flagellum brownish, gradually darkened distad; flagellar setal arranged in four rings. Labial and maxillary palpi unmarked, yellowish, but brownish and slightly flattened apically (Fig. 5 B, C, D). Thorax. Pronotum about 1.2 times as long as wide, laterally with two pairs of small black markings, medially with a pair of black transverse stripes and a pair of reddish cloudy bands; setae dark; transverse sulci present. Meso- and metanotum unmarked, or sometimes with a pair of black spots on metanotum (Fig. 5 A, B, C, E). Legs. Greenish, unmarked, covered with short black setae; claws curved, brown. Forewing. 12.2 – 14.1 mm long. Wing membrane transparent, rounded apically, tegula unmarked; veins mostly greenish, but 4 – 5 costal crossveins (c-sc) black at base; 6 – 11 c-sc, subcostal crossvein (sc-r), 1 – 2 radial crossveins (r-rs), crossvein between pseudocubitus and pseudomedia (psc-psm), CuA, CuP, A 1, and A 2 marked black. Costa area narrow basally, c-sc simple, straight, 17 costal crossveins present; basal crossvein between subcostal and radius present, crossveins posterior pterostigma absent; 8 radial crossviens, intramedian (im) cell triangular, subdistally connected by 1 rp-m crossvein to R; two gradate series of crossveins present, number of gradates (inner / outer): 3 / 6; gradate series not parallel, basal crossveins of first gradate series meeting PsM; distal cubital cell (dcc) open, CuP not forked (Fig. 5 A). Hind wing. 11.2 – 12.6 mm long. Pterostigma yellowish; veins greenish; 15 costal crossveins present; basal subcostal marked brown; six crossveins between PsC and PsM; two gradate series of crossveins, number of gradates (inner / outer): 3 / 5 (Fig. 5 A). Abdomen. Greenish; tergite 1 marked with two pairs of black spots, tergites 2 – 5 respectively marked with a pair of black stripes and two pairs of black spots; ventral margin slightly tinged with brown; sternites greenish, sternites 1 – 5 covered with short pale setae, sternites 6 – 9 (or 6 – 7 in female) with short black setae; spiracles small, round, not enlarged, atria not enlarged (Fig. 6 A, B). Male genitalia. Dorsal abdomen regular; tergite 9 and ectoprocts fused; ectoproct rounded; dorsal invagination shallow; thick spines on ectoproct absent; sternites 8 and 9 fused, regular, without strong apical spines; gonarcus medially fused, gonarcal bridge with two projecting horns and two longer, slender ventral processes on each side, acutely pointed at tip; gonarcal apodeme simple, with entoprocessus long, bending inward; gonarcus complex; pesudopenis constituted by a pair of extraordinarily asymmetrical pieces, mediuncus process absent; numerous gonosetae present; microtholi present (Fig. 6 A, C, D, E, F, G, H). Female genitalia. Tergite 9 and ectoprocts fused; sternite 7 simple, apically rounded; small sclerotized plate between subgenitale and sternite 7 absent; subgenitale broader than long, attached on a broad membranous structure; spermatheca normal; vela smaller than spermatheca; spermathecal duct curved (Fig. 6 B, I, J). Semaphorom I (Fig. 7 C, D). Body. Small, compact, flat ventrally, dorsal surface not abruptly elevated. Integument smooth, without microtrichia, bearing four types of setae: (i) medium length, stout, with acute tip (primary cephalic setae); (ii) long, robust, slightly denticulate to smooth, curved basally, curved-to-bent distally, with acute apex (most setae on lateral and laterodorsal tubercles of thorax and abdomen; LS, LDS); (iii) long, slender, smooth, curved submedian setae (SMS) on dorsum of mesothorax, metathorax, and first to sixth abdominal segments; (iv) short to medium length, straight, smooth, with acute tip. SMS extremely tapered and thin distally, being difficult to determine whether tips of these setae are acute or minutely hooked. Head. Dorsum smooth, well sclerotized; posterior margin quadrate, partially retracted into cervix; anterior region beneath base of antenna forming pedicellate extension. Six stemmata, all well separated, small. All primary cephalic setae (S 1 – S 12) present, with acute tips. S 11 robust, long, directed anteriorly; S 1, S 2, S 3, S 6, S 12 medium length, thinner than S 11; S 5 relatively small; anterior region of head with two pairs of small, smooth, acute setae; anterior tip of clypeus with a pair of large, slightly denticulate, acute setae projecting anteriorly. Venter with cardo and stipes robust, elongate, and rectangular; primary setae (S 8 – S 10) smooth, short to medium length; S 8 posterior to eye; S 9, S 10 near each other, medial to eye. Ventral midregion with three pairs of setae on or near mentum. Cephalic appendages. Clypeus large, extending laterally toward base of mandibles. Mandible short, stout, heavily sclerotized, with sharply acute tip. Maxilla broad basally, with two short basolateral setae; rounded, heavily sclerotized, with small patch of microsetae at tip. Labial palpus extending to or slightly exceeding tip of mandible; terminal segment rounded, tapering distally, terminus with small, pale, round projection bearing ventral pore and several microsetae apically. Basal palpomere with two pairs of long distal setae, one lateral, one mesal. Antennal pedicel elongate, tapering, with irregular annulations. Flagellum narrow, tapering distad, closely pressed against lateral margin of flagellum; terminus with two elongate terminal setae extending anteriorly, then curving toward each other, and with mesal seta usually longer than lateral one. Cephalic coloration. Anterodorsal surface pale; integument around and between stemmata dark brown; pedicellate dark brown dorsally, pale ventrally. Venter with anterior margin, sclerites dark brown; intersegmental membrane pale. Antenna with pedicel brownish; pedicel pale, with base and annulations brownish; flagellum brownish to amber. Mandibles and maxillae brownish basally. Thorax. Each segment with a pair of broad, thick, palmate, lateral tubercles (LTs); distal margin of each LT with robust chalazae bearing prominent setae (LS); LS long, robust, denticulate, dark brown at tip, with tip straight, unhooked; sclerites indistinct. Prothorax pale, smooth, well sclerotized on dorsal surface, with sparse setae, no microsetae; each LT with seven to eight LS; pronotal setae medium length, straight, with acute tips, arising from small chalazae. Meso- and metathorax dorsally with dense submedian setae (SMS) dark brown, no microsetae; LTs similar to those on prothorax, each bearing eight to ten long LS; laterodorsal tubercles (LDTs) absent; SMS arranged in two broad bands along anterior and posterior margins of each segment; SMS medium length, slender. Spiracular seta (SSp) not identified. Leg. Brownish distally, pale basally; setae pale, with acute tips. Coxa elongate, with few setae; femur with sparse setae; tibia with numerous setae, separated from tarsus; claws slender, deeply cleft; empodium long, with elongate bristle beneath. Abdomen. First segment (A 1) short, narrow, without spiracle, LT, or LDT, with transverse band of dense SMS dorsally. Segments A 2 – A 5 longer and broader than A 1, bearing a pair of bulbous LTs, round spiracular opening near dorsomesal margin of LT, without laterodosal tubercles (LDTs). LTs brownish dorsally, with two denticulate LS, no microsetae; segment with transverse band of dense SMS dorsally. Segments A 6 – A 7 each with a pair of laterodorsal tubercles (LDTs) near anteromesal margin of LT base. LDTs bearing two or three robust, denticulate, acute setae (LDS), one long, others short; segments without microsetae, posterior section without setae. Dorsum of A 7 with a pair of setae (SSp) associated with spiracles, two pairs of anterior setae between spiracles, two pairs of longer, more robust setae between LTs, a pair of setae near posterior margin. Segment A 8 well sclerotized dorsally; LT short, bulbous laterally, with robust, denticulate LS (one longer than others); with two pairs of robust setae in midsection between LTs, two pairs of short, smooth, acute, setae anterolaterally. Segment A 9 tubular, heavily sclerotized posteriorly; anterior section with pair of very small setae; midsection with single pair of long, robust setae laterally. Segment A 10 without setae except for single pair of smooth, acute setae near terminus. Semaphorom III (Fig. 7 A, B, E, F, G). Body. Stocky, globose dorsally, flat ventrally; thoracic, abdominal nota wide, extending fully over sides of body, with LTs extending laterally from ventral margins of nota. Thorax and abdomen with dark transverse bands, separated by pale bands and intersegmental membrane. Four types of setae: (i) smooth, unhooked; (ii) stout, short, straight, with acute tip; (iii) stout, with blunt to acute tip; (iv) simple, small, straight, with acute tip (Fig. 7 G). Head. Nearly quadrate; anterior margin slightly convex; no noticeable markings; dorsal setae dark (Fig. 7 A, B, E, F). Head appendages. Mandible short, stout, with acute tip. Antenna short, robust, tapering; scape with stout setae on distolateral margin; pedicel annulated; flagellum tapered, apparently with elongate terminal setae Cervix dark, probably well sclerotized, at least on lateral portion (Fig. 7 A, B, E, F, G). Head coloration. Anterodorsal surface of head entirely dark brown, with brownish marking at median, and a pair of irregular broad band extending from margin of each eye to posterior, but not meet each other; integument around and between stemmata dark brown. Venter margin dark brown; intersegmental membrane pale. Antenna with scape, base of pedicel dark brown; pedicel dark brown; pedicel with annulations brownish basally; flagellum brownish to amber. Mandibles and maxillae brownish basally (Fig. 7 A, B, E, F, G). Thorax. Segments broad, dorsoventrally thickened, each with a pair of LTs; LTs robust, rounded distally, with distal margin bearing robust LS, with dorsal surface bearing sparse acute setae; prothorax with two subsegments, mesothorax with three subsegments, metathorax apparently with one. Legs stocky, brownish, but claws darker; tarsi particularly short (Fig. 7 G). Abdomen. Segments A 1 – A 6 broad, thick; together with thorax forming large, densely setose, dorsal arch of body; A 1 with only one visible subsegment, without LTs, dorsally about as long and wide as metathoracic posterior subsegment, excluding LTs. Segments A 2 – A 6 each with two subsegments dorsally, subsegments merging above LTs; LTs round, spherical distally, with short base, bearing robust, curved, or bent LS distally, smaller, hooked setae dorsally. Segments A 7 – A 10 without distinct subsegment; each segment narrower than, and probably partially retractable within preceding segment; surfaces with sparse, short, acute setae. A 7 with LTs about as long as those on A 5 or A 6, but much narrower, their apices with dense covering of robust, acute LS extending posteriorly; spiracles near anterior margin of segment. A 8 with small lateral LTs bearing short, slender, acute setae; spiracles at base of segment. A 9, A 10 conical (LTs absent), with short slender, acute setae (Fig. 7 G).	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143813FFF8FF7A3477FD67FE00.taxon	materials_examined	Material examined. 6 ♁ 6 ♀, CHINA, Guangdong, Zhanjiang, sisal plantation of South Subtropical Crops Research Institute CATAS, 21 ° 17 ′ N, 110 ° 29 ′ E, VI. 2019, Ziyuan Li (CAU). Larval specimens examined. First instar, 5 individuals; second instar, 6 individuals; third instar, 5 individuals. All larvae reared from the eggs laid by females collected from above collecting site in Guangdong (CAU).	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
706976143813FFF8FF7A3477FD67FE00.taxon	distribution	Distribution. Australia, China, Indonesia, Malaysia, New Guinea, Western Pacific Islands (widespread). COI barcode sequence. AATAATATAGTAATAGCCCCGGCTAATACTGGTAAAGAAAGAAGAAGAAGTAAAGCTGTAATTACT ACTGATCAAACAAATAATGGTATTCGATCTAATGTTATATAGCTTAATCGTATATTAATTACTGTAGT AATGAAATTTACTGCCCCTAAAATAGAAGAAATTCCGGCAAGGTGTAAACTAAAAATAGCTAAATC AACAGATGCCCCAGCATGAGCAATACTAGATGAAAGAGGAGGGTACACAGTTCAACCTGTCCCAGC ACCTCTTTCTACTATAGACGAAGCAAGTAATAATGTTAAGGAAGGAGGAAGTATTCAAAATCTTATA TTATTTATTCGAGGAAAAGCTATATCAGGGGCTGCTAATATTAGTGGAACTAATCAATTTCCAAACC CACCAATTACAATAGGTATTACTATGAAAAAAATTATAATAAAAGCATGAGCTGTAACAATTACAT TATAAATTTGATCATCTCCAATTAGAGATCCAGGTTGTCCTAATTCAGCTCGAATTAATAAACTTAA TCTAGTTCCAACTAATCCTGACCAAATTCCAAAAATAAAATAAAGGGTACCAATATCCTTATGATTT GTTGAAAATAACCATTGTCGCATCAAACA	en	Wang, Maozhi, Li, Ziyuan, Liu, Xingyue (2023): A new species of Apertochrysa Tjeder, 1966 and new record of Plesiochrysa ramburi (Schneider, 1851) (Neuroptera: Chrysopidae) from China, with potential biocontrol significance. Zootaxa 5360 (4): 568-582, DOI: 10.11646/zootaxa.5360.4.6, URL: https://www.mapress.com/zt/article/download/zootaxa.5360.4.6/52134
